Review



dsred mir30 fragment  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc dsred mir30 fragment
    Dsred Mir30 Fragment, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dsred+mir30+fragment/TRMPVIR+(Plasmid+%2327994)/pm36416169-309-55-59
    Average 93 stars, based on 12 article reviews
    dsred mir30 fragment - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Expressing:

    Article Title: Loss of KDM6A confers drug resistance in acute myeloid leukemia
    Article Snippet: .. Lentiviruses expressing KDM6A-targeting shRNA #3 (5′- TACTTGAATAGCACCTTCCGA-3′), #4 (5′-TTTAATGGCATCCTGAGGCTG-3′), #7 (5′-TTTATCAATAGACTGCCTGTA-3′) or control shRNA targeting Renilla (5′- TAGATAAGCATTATAATTCCT-3′) or eGFP (5′-CAGCCACAACGTCTATATCAT-3′) were generated by cloning into the pCDH-EF1α-MCS-T2A-copGFP vector (SBI, CD521A-1). dsRED-miR30 fragment (TRMPVIR vector; Addgene #27994) was amplified using primers carrying MfeI and SalI as 5’ and 3’ restriction sites. .. The 22mer shRNA target sequences have been synthetized as part of 110bps ssDNA oligos (Eurofins Scientific, Luxembourg), annealed and cloned into the vector.

    shRNA:

    Article Title: Loss of KDM6A confers drug resistance in acute myeloid leukemia
    Article Snippet: .. Lentiviruses expressing KDM6A-targeting shRNA #3 (5′- TACTTGAATAGCACCTTCCGA-3′), #4 (5′-TTTAATGGCATCCTGAGGCTG-3′), #7 (5′-TTTATCAATAGACTGCCTGTA-3′) or control shRNA targeting Renilla (5′- TAGATAAGCATTATAATTCCT-3′) or eGFP (5′-CAGCCACAACGTCTATATCAT-3′) were generated by cloning into the pCDH-EF1α-MCS-T2A-copGFP vector (SBI, CD521A-1). dsRED-miR30 fragment (TRMPVIR vector; Addgene #27994) was amplified using primers carrying MfeI and SalI as 5’ and 3’ restriction sites. .. The 22mer shRNA target sequences have been synthetized as part of 110bps ssDNA oligos (Eurofins Scientific, Luxembourg), annealed and cloned into the vector.

    Article Title: X-linked inhibitor of apoptosis protein represents a promising therapeutic target for relapsed/refractory ALL.
    Article Snippet: Acute lymphoblastic leukemia (ALL) represents the most frequent malignancy in children, and relapse/refractory (r/r) disease is difficult to treat, both in children and adults.. In search for novel treatment options against r/r ALL, we studied inhibitor of apoptosis proteins (IAP) and Smac mimetics (SM).. SM-sensitized r/r ALL cells towards conventional chemotherapy, even upon resistance against SM alone.

    Article Title: X‐linked inhibitor of apoptosis protein represents a promising therapeutic target for relapsed/refractory ALL
    Article Snippet: .. XIAP over‐expression: For over‐expression of XIAP, the full‐length CDS of XIAP (gBlock, IDT) was cloned into the pCDH‐vector backbone (System Biosciences) using EcoRI and BamHI and linked by a T2A fragment to mTagBFP, used as marker. shRNA expression system: The construct encoding for dsRED and the miR30 KD cassette was generated by cloning the PCR‐amplified dsRED‐miR30 fragment (TRMPVIR vector; Addgene #27994) into the pCDH‐EF1α‐MCS‐T2A‐copGFP vector (SBI, CD521A‐1) using primers carrying MfeI and SalI as 5′ and 3′ restriction sites. .. The target sequences for eGFP (CCAGCCACAACGTCTATATCAT) and XIAP (sh‐XIAP.1 AAAGCATCATACTATAACTGAA and sh‐XIAP.2 CGAGGTTGGTTGTTGTGTTTTA) have been synthetized as part of 110 bp ss‐DNA oligos (shRNAmiR30 backbone, Eurofins), annealed and cloned into the vector using XhoI and EcoRI.

    Control:

    Article Title: Loss of KDM6A confers drug resistance in acute myeloid leukemia
    Article Snippet: .. Lentiviruses expressing KDM6A-targeting shRNA #3 (5′- TACTTGAATAGCACCTTCCGA-3′), #4 (5′-TTTAATGGCATCCTGAGGCTG-3′), #7 (5′-TTTATCAATAGACTGCCTGTA-3′) or control shRNA targeting Renilla (5′- TAGATAAGCATTATAATTCCT-3′) or eGFP (5′-CAGCCACAACGTCTATATCAT-3′) were generated by cloning into the pCDH-EF1α-MCS-T2A-copGFP vector (SBI, CD521A-1). dsRED-miR30 fragment (TRMPVIR vector; Addgene #27994) was amplified using primers carrying MfeI and SalI as 5’ and 3’ restriction sites. .. The 22mer shRNA target sequences have been synthetized as part of 110bps ssDNA oligos (Eurofins Scientific, Luxembourg), annealed and cloned into the vector.

    Generated:

    Article Title: Loss of KDM6A confers drug resistance in acute myeloid leukemia
    Article Snippet: .. Lentiviruses expressing KDM6A-targeting shRNA #3 (5′- TACTTGAATAGCACCTTCCGA-3′), #4 (5′-TTTAATGGCATCCTGAGGCTG-3′), #7 (5′-TTTATCAATAGACTGCCTGTA-3′) or control shRNA targeting Renilla (5′- TAGATAAGCATTATAATTCCT-3′) or eGFP (5′-CAGCCACAACGTCTATATCAT-3′) were generated by cloning into the pCDH-EF1α-MCS-T2A-copGFP vector (SBI, CD521A-1). dsRED-miR30 fragment (TRMPVIR vector; Addgene #27994) was amplified using primers carrying MfeI and SalI as 5’ and 3’ restriction sites. .. The 22mer shRNA target sequences have been synthetized as part of 110bps ssDNA oligos (Eurofins Scientific, Luxembourg), annealed and cloned into the vector.

    Article Title: X-linked inhibitor of apoptosis protein represents a promising therapeutic target for relapsed/refractory ALL.
    Article Snippet: Acute lymphoblastic leukemia (ALL) represents the most frequent malignancy in children, and relapse/refractory (r/r) disease is difficult to treat, both in children and adults.. In search for novel treatment options against r/r ALL, we studied inhibitor of apoptosis proteins (IAP) and Smac mimetics (SM).. SM-sensitized r/r ALL cells towards conventional chemotherapy, even upon resistance against SM alone.

    Article Title: X‐linked inhibitor of apoptosis protein represents a promising therapeutic target for relapsed/refractory ALL
    Article Snippet: .. XIAP over‐expression: For over‐expression of XIAP, the full‐length CDS of XIAP (gBlock, IDT) was cloned into the pCDH‐vector backbone (System Biosciences) using EcoRI and BamHI and linked by a T2A fragment to mTagBFP, used as marker. shRNA expression system: The construct encoding for dsRED and the miR30 KD cassette was generated by cloning the PCR‐amplified dsRED‐miR30 fragment (TRMPVIR vector; Addgene #27994) into the pCDH‐EF1α‐MCS‐T2A‐copGFP vector (SBI, CD521A‐1) using primers carrying MfeI and SalI as 5′ and 3′ restriction sites. .. The target sequences for eGFP (CCAGCCACAACGTCTATATCAT) and XIAP (sh‐XIAP.1 AAAGCATCATACTATAACTGAA and sh‐XIAP.2 CGAGGTTGGTTGTTGTGTTTTA) have been synthetized as part of 110 bp ss‐DNA oligos (shRNAmiR30 backbone, Eurofins), annealed and cloned into the vector using XhoI and EcoRI.

    Cloning:

    Article Title: Loss of KDM6A confers drug resistance in acute myeloid leukemia
    Article Snippet: .. Lentiviruses expressing KDM6A-targeting shRNA #3 (5′- TACTTGAATAGCACCTTCCGA-3′), #4 (5′-TTTAATGGCATCCTGAGGCTG-3′), #7 (5′-TTTATCAATAGACTGCCTGTA-3′) or control shRNA targeting Renilla (5′- TAGATAAGCATTATAATTCCT-3′) or eGFP (5′-CAGCCACAACGTCTATATCAT-3′) were generated by cloning into the pCDH-EF1α-MCS-T2A-copGFP vector (SBI, CD521A-1). dsRED-miR30 fragment (TRMPVIR vector; Addgene #27994) was amplified using primers carrying MfeI and SalI as 5’ and 3’ restriction sites. .. The 22mer shRNA target sequences have been synthetized as part of 110bps ssDNA oligos (Eurofins Scientific, Luxembourg), annealed and cloned into the vector.

    Article Title: X-linked inhibitor of apoptosis protein represents a promising therapeutic target for relapsed/refractory ALL.
    Article Snippet: Acute lymphoblastic leukemia (ALL) represents the most frequent malignancy in children, and relapse/refractory (r/r) disease is difficult to treat, both in children and adults.. In search for novel treatment options against r/r ALL, we studied inhibitor of apoptosis proteins (IAP) and Smac mimetics (SM).. SM-sensitized r/r ALL cells towards conventional chemotherapy, even upon resistance against SM alone.

    Article Title: X‐linked inhibitor of apoptosis protein represents a promising therapeutic target for relapsed/refractory ALL
    Article Snippet: .. XIAP over‐expression: For over‐expression of XIAP, the full‐length CDS of XIAP (gBlock, IDT) was cloned into the pCDH‐vector backbone (System Biosciences) using EcoRI and BamHI and linked by a T2A fragment to mTagBFP, used as marker. shRNA expression system: The construct encoding for dsRED and the miR30 KD cassette was generated by cloning the PCR‐amplified dsRED‐miR30 fragment (TRMPVIR vector; Addgene #27994) into the pCDH‐EF1α‐MCS‐T2A‐copGFP vector (SBI, CD521A‐1) using primers carrying MfeI and SalI as 5′ and 3′ restriction sites. .. The target sequences for eGFP (CCAGCCACAACGTCTATATCAT) and XIAP (sh‐XIAP.1 AAAGCATCATACTATAACTGAA and sh‐XIAP.2 CGAGGTTGGTTGTTGTGTTTTA) have been synthetized as part of 110 bp ss‐DNA oligos (shRNAmiR30 backbone, Eurofins), annealed and cloned into the vector using XhoI and EcoRI.

    Plasmid Preparation:

    Article Title: Loss of KDM6A confers drug resistance in acute myeloid leukemia
    Article Snippet: .. Lentiviruses expressing KDM6A-targeting shRNA #3 (5′- TACTTGAATAGCACCTTCCGA-3′), #4 (5′-TTTAATGGCATCCTGAGGCTG-3′), #7 (5′-TTTATCAATAGACTGCCTGTA-3′) or control shRNA targeting Renilla (5′- TAGATAAGCATTATAATTCCT-3′) or eGFP (5′-CAGCCACAACGTCTATATCAT-3′) were generated by cloning into the pCDH-EF1α-MCS-T2A-copGFP vector (SBI, CD521A-1). dsRED-miR30 fragment (TRMPVIR vector; Addgene #27994) was amplified using primers carrying MfeI and SalI as 5’ and 3’ restriction sites. .. The 22mer shRNA target sequences have been synthetized as part of 110bps ssDNA oligos (Eurofins Scientific, Luxembourg), annealed and cloned into the vector.

    Article Title: X-linked inhibitor of apoptosis protein represents a promising therapeutic target for relapsed/refractory ALL.
    Article Snippet: Acute lymphoblastic leukemia (ALL) represents the most frequent malignancy in children, and relapse/refractory (r/r) disease is difficult to treat, both in children and adults.. In search for novel treatment options against r/r ALL, we studied inhibitor of apoptosis proteins (IAP) and Smac mimetics (SM).. SM-sensitized r/r ALL cells towards conventional chemotherapy, even upon resistance against SM alone.

    Article Title: X‐linked inhibitor of apoptosis protein represents a promising therapeutic target for relapsed/refractory ALL
    Article Snippet: .. XIAP over‐expression: For over‐expression of XIAP, the full‐length CDS of XIAP (gBlock, IDT) was cloned into the pCDH‐vector backbone (System Biosciences) using EcoRI and BamHI and linked by a T2A fragment to mTagBFP, used as marker. shRNA expression system: The construct encoding for dsRED and the miR30 KD cassette was generated by cloning the PCR‐amplified dsRED‐miR30 fragment (TRMPVIR vector; Addgene #27994) into the pCDH‐EF1α‐MCS‐T2A‐copGFP vector (SBI, CD521A‐1) using primers carrying MfeI and SalI as 5′ and 3′ restriction sites. .. The target sequences for eGFP (CCAGCCACAACGTCTATATCAT) and XIAP (sh‐XIAP.1 AAAGCATCATACTATAACTGAA and sh‐XIAP.2 CGAGGTTGGTTGTTGTGTTTTA) have been synthetized as part of 110 bp ss‐DNA oligos (shRNAmiR30 backbone, Eurofins), annealed and cloned into the vector using XhoI and EcoRI.

    Amplification:

    Article Title: Loss of KDM6A confers drug resistance in acute myeloid leukemia
    Article Snippet: .. Lentiviruses expressing KDM6A-targeting shRNA #3 (5′- TACTTGAATAGCACCTTCCGA-3′), #4 (5′-TTTAATGGCATCCTGAGGCTG-3′), #7 (5′-TTTATCAATAGACTGCCTGTA-3′) or control shRNA targeting Renilla (5′- TAGATAAGCATTATAATTCCT-3′) or eGFP (5′-CAGCCACAACGTCTATATCAT-3′) were generated by cloning into the pCDH-EF1α-MCS-T2A-copGFP vector (SBI, CD521A-1). dsRED-miR30 fragment (TRMPVIR vector; Addgene #27994) was amplified using primers carrying MfeI and SalI as 5’ and 3’ restriction sites. .. The 22mer shRNA target sequences have been synthetized as part of 110bps ssDNA oligos (Eurofins Scientific, Luxembourg), annealed and cloned into the vector.

    Clone Assay:

    Article Title: X-linked inhibitor of apoptosis protein represents a promising therapeutic target for relapsed/refractory ALL.
    Article Snippet: Acute lymphoblastic leukemia (ALL) represents the most frequent malignancy in children, and relapse/refractory (r/r) disease is difficult to treat, both in children and adults.. In search for novel treatment options against r/r ALL, we studied inhibitor of apoptosis proteins (IAP) and Smac mimetics (SM).. SM-sensitized r/r ALL cells towards conventional chemotherapy, even upon resistance against SM alone.

    Article Title: X‐linked inhibitor of apoptosis protein represents a promising therapeutic target for relapsed/refractory ALL
    Article Snippet: .. XIAP over‐expression: For over‐expression of XIAP, the full‐length CDS of XIAP (gBlock, IDT) was cloned into the pCDH‐vector backbone (System Biosciences) using EcoRI and BamHI and linked by a T2A fragment to mTagBFP, used as marker. shRNA expression system: The construct encoding for dsRED and the miR30 KD cassette was generated by cloning the PCR‐amplified dsRED‐miR30 fragment (TRMPVIR vector; Addgene #27994) into the pCDH‐EF1α‐MCS‐T2A‐copGFP vector (SBI, CD521A‐1) using primers carrying MfeI and SalI as 5′ and 3′ restriction sites. .. The target sequences for eGFP (CCAGCCACAACGTCTATATCAT) and XIAP (sh‐XIAP.1 AAAGCATCATACTATAACTGAA and sh‐XIAP.2 CGAGGTTGGTTGTTGTGTTTTA) have been synthetized as part of 110 bp ss‐DNA oligos (shRNAmiR30 backbone, Eurofins), annealed and cloned into the vector using XhoI and EcoRI.

    Marker:

    Article Title: X-linked inhibitor of apoptosis protein represents a promising therapeutic target for relapsed/refractory ALL.
    Article Snippet: Acute lymphoblastic leukemia (ALL) represents the most frequent malignancy in children, and relapse/refractory (r/r) disease is difficult to treat, both in children and adults.. In search for novel treatment options against r/r ALL, we studied inhibitor of apoptosis proteins (IAP) and Smac mimetics (SM).. SM-sensitized r/r ALL cells towards conventional chemotherapy, even upon resistance against SM alone.

    Article Title: X‐linked inhibitor of apoptosis protein represents a promising therapeutic target for relapsed/refractory ALL
    Article Snippet: .. XIAP over‐expression: For over‐expression of XIAP, the full‐length CDS of XIAP (gBlock, IDT) was cloned into the pCDH‐vector backbone (System Biosciences) using EcoRI and BamHI and linked by a T2A fragment to mTagBFP, used as marker. shRNA expression system: The construct encoding for dsRED and the miR30 KD cassette was generated by cloning the PCR‐amplified dsRED‐miR30 fragment (TRMPVIR vector; Addgene #27994) into the pCDH‐EF1α‐MCS‐T2A‐copGFP vector (SBI, CD521A‐1) using primers carrying MfeI and SalI as 5′ and 3′ restriction sites. .. The target sequences for eGFP (CCAGCCACAACGTCTATATCAT) and XIAP (sh‐XIAP.1 AAAGCATCATACTATAACTGAA and sh‐XIAP.2 CGAGGTTGGTTGTTGTGTTTTA) have been synthetized as part of 110 bp ss‐DNA oligos (shRNAmiR30 backbone, Eurofins), annealed and cloned into the vector using XhoI and EcoRI.

    Construct:

    Article Title: X-linked inhibitor of apoptosis protein represents a promising therapeutic target for relapsed/refractory ALL.
    Article Snippet: Acute lymphoblastic leukemia (ALL) represents the most frequent malignancy in children, and relapse/refractory (r/r) disease is difficult to treat, both in children and adults.. In search for novel treatment options against r/r ALL, we studied inhibitor of apoptosis proteins (IAP) and Smac mimetics (SM).. SM-sensitized r/r ALL cells towards conventional chemotherapy, even upon resistance against SM alone.

    Article Title: X‐linked inhibitor of apoptosis protein represents a promising therapeutic target for relapsed/refractory ALL
    Article Snippet: .. XIAP over‐expression: For over‐expression of XIAP, the full‐length CDS of XIAP (gBlock, IDT) was cloned into the pCDH‐vector backbone (System Biosciences) using EcoRI and BamHI and linked by a T2A fragment to mTagBFP, used as marker. shRNA expression system: The construct encoding for dsRED and the miR30 KD cassette was generated by cloning the PCR‐amplified dsRED‐miR30 fragment (TRMPVIR vector; Addgene #27994) into the pCDH‐EF1α‐MCS‐T2A‐copGFP vector (SBI, CD521A‐1) using primers carrying MfeI and SalI as 5′ and 3′ restriction sites. .. The target sequences for eGFP (CCAGCCACAACGTCTATATCAT) and XIAP (sh‐XIAP.1 AAAGCATCATACTATAACTGAA and sh‐XIAP.2 CGAGGTTGGTTGTTGTGTTTTA) have been synthetized as part of 110 bp ss‐DNA oligos (shRNAmiR30 backbone, Eurofins), annealed and cloned into the vector using XhoI and EcoRI.

    Polymerase Chain Reaction:

    Article Title: X‐linked inhibitor of apoptosis protein represents a promising therapeutic target for relapsed/refractory ALL
    Article Snippet: .. XIAP over‐expression: For over‐expression of XIAP, the full‐length CDS of XIAP (gBlock, IDT) was cloned into the pCDH‐vector backbone (System Biosciences) using EcoRI and BamHI and linked by a T2A fragment to mTagBFP, used as marker. shRNA expression system: The construct encoding for dsRED and the miR30 KD cassette was generated by cloning the PCR‐amplified dsRED‐miR30 fragment (TRMPVIR vector; Addgene #27994) into the pCDH‐EF1α‐MCS‐T2A‐copGFP vector (SBI, CD521A‐1) using primers carrying MfeI and SalI as 5′ and 3′ restriction sites. .. The target sequences for eGFP (CCAGCCACAACGTCTATATCAT) and XIAP (sh‐XIAP.1 AAAGCATCATACTATAACTGAA and sh‐XIAP.2 CGAGGTTGGTTGTTGTGTTTTA) have been synthetized as part of 110 bp ss‐DNA oligos (shRNAmiR30 backbone, Eurofins), annealed and cloned into the vector using XhoI and EcoRI.



    Similar Products

    dsred mir30 fragment  (Addgene inc)
    93
    Addgene inc dsred mir30 fragment
    Dsred Mir30 Fragment, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dsred+mir30+fragment/TRMPVIR+(Plasmid+%2327994)/pm36416169-309-55-59
    Average 93 stars, based on 1 article reviews
    dsred mir30 fragment - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results